Sequence ID | >WENV170001006 |
Genome ID | AGBJ01000377 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 4157 |
End posion on genome | 4080 |
Amino Acid | Pro |
Anticodon | CGG |
Upstream region at tRNA start position |
ttcattatat |
tRNA gene sequence |
CGGGATGTAGCGCAGCCAGGTCAGCGCGCTTCGTTCGGGACGAAGAAGTCGCCGGTTCAA |
Downstream region at tRNA end position |
tttattatca |
Secondary structure (Cloverleaf model) | >WENV170001006 Pro CGG t ACCA tttattatca C - G G - C G - C G - C A - T T - A G - C T A T C G G C C A C C G A A | | | | | A A C G C G G C C G G C G | | | | T T G G C G C T C A G AAGTC C - G T - A T - A C - G G - C T A T G C G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |