Sequence ID | >WENV170001008 |
Genome ID | AGBJ01000439 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 1250 |
End posion on genome | 1161 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
agtatatgac |
tRNA gene sequence |
GGAGAGGTGTCCGAGTGGTTTATGGAGCACGCTTGGAAAGCGTGTGTAGATTAACGTTTA |
Downstream region at tRNA end position |
tttttaatgg |
Secondary structure (Cloverleaf model) | >WENV170001008 Ser GGA c GCCA tttttaatgg G - C G - C A - T G - C A - T G - C G - C T A T C G C C C A T G A G | | | | | G G G C C T G C G G G C G + | | | T T T T G G A T T A G TGTAGATTAACGTTTACC C - G A - T C - G G - C C - G T A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |