Sequence ID | >WENV170001009 |
Genome ID | AGBJ01000439 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 1152 |
End posion on genome | 1062 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
catttttaat |
tRNA gene sequence |
GGAGAGATGCCAGAGCGGTCGAATGGGACGGTCTCGAAAATCGTTGTCCGTCAGTGACGG |
Downstream region at tRNA end position |
tttaaggttt |
Secondary structure (Cloverleaf model) | >WENV170001009 Ser CGA t GCCA tttaaggttt G - C G - C A - T G - C A - T G - C A - T T A T C A C C C A C G A G | | | | | G G G A C C G T G G G C G | | | T T T A T G G C G A G TGTCCGTCAGTGACGGACC A - T C - G G - C G + T T - A C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |