Sequence ID | >WENV170001010 |
Genome ID | AGBJ01000500 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 2803 |
End posion on genome | 2729 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
tttagttttg |
tRNA gene sequence |
GCGGGAATAGCTCAGTGGTAGAGCTCTACCTTGCCAAGGTAGATGTCGCGGGTTCAAATC |
Downstream region at tRNA end position |
ttttctcggc |
Secondary structure (Cloverleaf model) | >WENV170001010 Gly GCC g TCCA ttttctcggc G - C C - G G - C G - C G - C A - T A - T T A T T G C C C A G A A + | | | | A T C T C G G C G G G C G | | | | T T G G A G C T A T ATGTC C - G T - A A - T C - G C - G T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |