Sequence ID | >WENV170001011 |
Genome ID | AGBJ01000500 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 2721 |
End posion on genome | 2647 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
ccattttctc |
tRNA gene sequence |
GGCGACATAGCCAAGTGGTAAGGCAGGGGTCTGCAAAATCCTTATTCCTCGGTTCAAATC |
Downstream region at tRNA end position |
tttttttaat |
Secondary structure (Cloverleaf model) | >WENV170001011 Cys GCA c TCCA tttttttaat G - C G - C C - G G - C A - T C - G A - T T A T G G G C C A G A A | + | | | A T A C C G C T C G G C G | | | T T G A G G C T A A TATTC G + T G - C G - C G + T T - A C A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |