Sequence ID | >WENV170001015 |
Genome ID | AGBJ01000539 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 2312 |
End posion on genome | 2388 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
ttactatatt |
tRNA gene sequence |
CGGGGCGTGGCGCAGTCTGGTAGCGCACCTGCTTTGGGAGCAGGAAGTCGAAGGTTCAAA |
Downstream region at tRNA end position |
gaattatttg |
Secondary structure (Cloverleaf model) | >WENV170001015 Pro TGG t ACCA gaattatttg C - G G - C G - C G - C G - C C - G G - C T A T T T T C C A T G A G + | | | | A C C G C G G A A G G C T | | | | T T G G C G C G T A A AAGTC C - G C - G T - A G - C C - G T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |