Sequence ID | >WENV170001017 |
Genome ID | AGBJ01000559 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 1954 |
End posion on genome | 2041 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
aatatcaaat |
tRNA gene sequence |
GCCTGGGTGGCGGAATTGGTAGACGCAAGGGACTTAAAATCCCTCGGTCTTAATGGCTGT |
Downstream region at tRNA end position |
tactaagggt |
Secondary structure (Cloverleaf model) | >WENV170001017 Leu TAA t ACCA tactaagggt G - C C - G C - G T - A G - C G - C G - C T T T T G C C C A T A A G | | | | | G T G G C G A C G G G C G | | | T T G A C G C T A G A CGGTCTTAATGGCTGT A - T G - C G - C G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |