Sequence ID | >WENV170001018 |
Genome ID | AGBJ01000588 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 2171 |
End posion on genome | 2256 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
tcataaaagt |
tRNA gene sequence |
GCGAAAGTGGCGGAACGGCAGACGCGCTGGATTTAGGATCCAGTGGGATCTTTCCTGTAG |
Downstream region at tRNA end position |
taaattcaaa |
Secondary structure (Cloverleaf model) | >WENV170001018 Leu TAG t ACCA taaattcaaa G - C C - G G - C A - T A - T A - T G - C T A T T C C C C A C A A G | | | | | G G G G C G A G G G G C G | | | T T C A C G C A G G TGGGATCTTTCCTGT C - G T - A G - C G - C A - T T A T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |