Sequence ID | >WENV170001019 |
Genome ID | AGBJ01000650 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 1421 |
End posion on genome | 1350 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
acaaaaaaat |
tRNA gene sequence |
GCCACCATAGCTCAGAGGTAGAGCAACTGATTCGTAATCAGTTGGTCGTGGGTTCAATTC |
Downstream region at tRNA end position |
ttaaaaaatt |
Secondary structure (Cloverleaf model) | >WENV170001019 Thr CGT t Ttat ttaaaaaatt G - C C - G C - G A - T C - G C - G A - T T T T C G C C C A G A A | + | | | A A C T C G G T G G G C G | | | | T T G G A G C T A A TGGTC A - T C - G T - A G - C A - T T A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |