Sequence ID | >WENV170001020 |
Genome ID | AGBJ01000732 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 2809 |
End posion on genome | 2885 |
Amino Acid | Pro |
Anticodon | CGG |
Upstream region at tRNA start position |
tagataaagt |
tRNA gene sequence |
CGGGACGTGGCTCAGTCTGGTAGAGCACAGCGTTCGGGACGCTGGGGTCGCTGGTTCAAA |
Downstream region at tRNA end position |
taacatttta |
Secondary structure (Cloverleaf model) | >WENV170001020 Pro CGG t ACCA taacatttta C - G G - C G - C G - C A - T C - G G - C T A T T G A C C A T G A G + | | | | A C C T C G G C T G G C T | | | | T T G G A G C G T A A GGGTC C - G A - T G - C C - G G - C T A T G C G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |