Sequence ID | >WENV170001023 |
Genome ID | AGBJ01000821 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 971 |
End posion on genome | 1046 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
ccaagaaaaa |
tRNA gene sequence |
GGCGGCATAGCCAAGTGGCTAAGGCAGCGGTCTGCAAAACCGTTTTACACCGGTTCGAAT |
Downstream region at tRNA end position |
atttttatta |
Secondary structure (Cloverleaf model) | >WENV170001023 Cys GCA a TCCA atttttatta G - C G - C C - G G - C G - C C - G A - T T A T T G G C C A T G A A | | | | | G G A C C G A C C G G C G | | | T T C A G G C T A A TTTAC G + T C - G G - C G - C T - A C A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |