Sequence ID | >WENV170001024 |
Genome ID | AGBJ01000835 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 2260 |
End posion on genome | 2185 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
aaataaaaag |
tRNA gene sequence |
GCCACCGTAGCTCAGATGGCAGAGCACCTCACTCGTAATGAGGATGTCGGCGGTTCGACC |
Downstream region at tRNA end position |
atattcttct |
Secondary structure (Cloverleaf model) | >WENV170001024 Thr CGT g TCGA atattcttct G - C C - G C - G A - T C - G C - G G - C C C T C C G C C A A G A A | | | | | G T C T C G G G C G G C G | | | | T T G G A G C C A A ATGTC C - G C - G T - A C - G A - T C A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |