Sequence ID | >WENV170001025 |
Genome ID | AGBJ01000847 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 1848 |
End posion on genome | 1773 |
Amino Acid | Ala |
Anticodon | CGC |
Upstream region at tRNA start position |
gggtaataat |
tRNA gene sequence |
GGGGATGTAGCTCAGATGGGAGAGCGGCACGTTCGCAACGTACAGGTCAGGGGTTCGATT |
Downstream region at tRNA end position |
cttttgagga |
Secondary structure (Cloverleaf model) | >WENV170001025 Ala CGC t ACCA cttttgagga G - C G - C G + T G - C A - T T - A G - C T T T T C C C C A A G A A | | | | | G T C T C G A G G G G C G | | | | T T G G A G C G A G AGGTC G - C C A A - T C - G G - C T A T A C G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |