Sequence ID | >WENV170001028 |
Genome ID | AGBJ01001155 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 224 |
End posion on genome | 298 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
tagcttttga |
tRNA gene sequence |
GCGGGTATAACTCAGTGGCAGAGTATTAGCTTCCCAAGCTGAGAGTCGCGAGTTCGAATC |
Downstream region at tRNA end position |
ttttttatgg |
Secondary structure (Cloverleaf model) | >WENV170001028 Gly CCC a TCCA ttttttatgg G - C C - G G - C G - C G - C T - A A - T T A T T G C T C A G A A + | | | | G T C T C A G C G A G C G | | | | T T G G A G T C A A GAGTC T - A T + G A - T G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |