Sequence ID | >WENV170001030 |
Genome ID | AGBJ01001180 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 2096 |
End posion on genome | 2169 |
Amino Acid | Ala |
Anticodon | GGC |
Upstream region at tRNA start position |
ccgctatttc |
tRNA gene sequence |
GGGCCCATGGCTCAGCTGGTAGAGCGCATCTATGGCATAGATGAGGTCGTCGGTTCGAAT |
Downstream region at tRNA end position |
ttaaaggaac |
Secondary structure (Cloverleaf model) | >WENV170001030 Ala GGC c ACac ttaaaggaac G - C G - C G + T C - G C - G C - G A - T T A T C A G C C A C G A G | | | | | G T C T C G G T C G G C G | | | | T T G G A G C T A G AGGTC C - G A - T T - A C - G T - A A T T A G G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |