Sequence ID | >WENV170001032 |
Genome ID | AGBJ01001220 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 74 |
End posion on genome | 149 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
acttaattgg |
tRNA gene sequence |
GCGGGCATAGCTCAGTAGGTAGAGTACAAGCTTCCCAAGCTTGGGGTCGCGGGTTCGATC |
Downstream region at tRNA end position |
tgttattgta |
Secondary structure (Cloverleaf model) | >WENV170001032 Gly CCC g TCCA tgttattgta G - C C - G G - C G - C G - C C - G A - T C T T T G C C C A T G A A + | | | | G A C T C G G C G G G C G | | | + T T G G A G T T A A GGGTC C - G A - T A - T G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |