Sequence ID | >WENV170001035 |
Genome ID | AGBJ01001239 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 1997 |
End posion on genome | 2086 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
cataactgtt |
tRNA gene sequence |
GCCGGAGTGGTGGAATTGGTAGACACAAGGGACTTAAAATCCCTCGCCAATTATGTTGGT |
Downstream region at tRNA end position |
aagacccgtt |
Secondary structure (Cloverleaf model) | >WENV170001035 Leu TAA t ACTA aagacccgtt G + T C - G C - G G + T G - C A - T G - C T G T C G G C C A T A A G | + | | | G T G G T G G T C G G C G | | | T T G A C A C T A G A CGCCAATTATGTTGGTGT A - T G - C G - C G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |