Sequence ID | >WENV170001036 |
Genome ID | AGBJ01001264 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 320 |
End posion on genome | 245 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
ttctttatat |
tRNA gene sequence |
GGGCCAGTAACTCAGTCGGTAGAGTATCGCCCTTTTAAGGCGAGAGTCGAAGGTTCGAAT |
Downstream region at tRNA end position |
gctatatcgg |
Secondary structure (Cloverleaf model) | >WENV170001036 Lys TTT t ACCA gctatatcgg G - C G + T G - C C - G C - G A - T G - C T A T C T T C C A T G A A | | | | | G C C T C A G A A G G C G | | | | T T G G A G T T A A GAGTC T - A C - G G - C C - G C - G C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |