Sequence ID | >WENV170001037 |
Genome ID | AGBJ01001264 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 236 |
End posion on genome | 162 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
cagctatatc |
tRNA gene sequence |
GGCCCCATCGTCTAGTGGTTAGGACCTCAGGTTTTCATCCTGGTAGCAGGAGTTCGATTC |
Downstream region at tRNA end position |
ttttattaaa |
Secondary structure (Cloverleaf model) | >WENV170001037 Glu TTC c ACCA ttttattaaa G - C G + T C - G C - G C - G C - G A - T T T T T C C T C A T G A C | | | | | G G T C T G A G G A G C G + | | | T T T G G A C T A C TAGC T + G C - G A - T G - C G - C T T T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |