Sequence ID | >WENV170001038 |
Genome ID | AGBJ01001339 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 929 |
End posion on genome | 832 |
Amino Acid | SeC(p) |
Anticodon | TCA |
Upstream region at tRNA start position |
aaaccatttt |
tRNA gene sequence |
GGAAGTGGAAAGCTCACTGGTGGGGCTCCCGGACTTCAAATCCGGTGCGCGGGGCTAGAA |
Downstream region at tRNA end position |
ataaggatcc |
Secondary structure (Cloverleaf model) | >WENV170001038 SeC(p) TCA t GCCA ataaggatcc G - C G - C A - T A - T G - C T - A G - C G G T T A T A C C C A C A C A + | | | | G T T C G A G T G G G C G + | | | T T G G G C T T G G C TGCGCGGGGCTAGAACCCTCGCGG C - G C - G G - C G - C A - T C A T A T C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |