Sequence ID | >WENV170001040 |
Genome ID | AGBJ01001359 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 76 |
End posion on genome | 1 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
ttttacaaaa |
tRNA gene sequence |
GGGCCCATAGCTCAGCTGGCAGAGCCACCGGCTCATAACCGGTAGGTCCCTGGTTCGAAT |
Downstream region at tRNA end position |
nnnnnnnnnn |
Secondary structure (Cloverleaf model) | >WENV170001040 Met CAT a ATCA nnnnnnnnnn G - C G - C G - C C - G C - G C - G A - T T A T G G A C C A C G A A | | | | | G T C T C G C C T G G C G | | | | T T G G A G C C A C AGGTC A - T C - G C - G G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |