Sequence ID | >WENV170001041 |
Genome ID | AGBJ01001415 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 1563 |
End posion on genome | 1475 |
Amino Acid | Leu |
Anticodon | AAG |
Upstream region at tRNA start position |
aactccaatt |
tRNA gene sequence |
GCAGAAGTGGCGGAACTGGAAGACGCGCAAGACTAAGGATCTTGTGTCCGTATTCGGATG |
Downstream region at tRNA end position |
tccttttgaa |
Secondary structure (Cloverleaf model) | >WENV170001041 Leu AAG t ACCA tccttttgaa G - C C - G A - T G - C A - T A - T G - C T G T T C C C C A C A A G | | | | | G T G G C G A G G G G C G | | | T T G A C G C A A G G TGTCCGTATTCGGATGT C - G A - T A - T G - C A - T C A T G A A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |