Sequence ID | >WENV170001042 |
Genome ID | AGBJ01001415 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 1443 |
End posion on genome | 1367 |
Amino Acid | Arg |
Anticodon | ACG |
Upstream region at tRNA start position |
aacttaattt |
tRNA gene sequence |
GCGCCCATGGCTCAACTGGATAGAGCATCTGATTACGGATCAGAAGGGTCCCTGTTCGAA |
Downstream region at tRNA end position |
tcttttaatc |
Secondary structure (Cloverleaf model) | >WENV170001042 Arg ACG t ACCA tcttttaatc G + T C - G G - C C - G C - G C - G A - T T A T G G G G C A C A A G | | | + | G T C T C G C C C T G C G | | | | T T G G A G C A T A A AGGGT T - A C - G T - A G - C A - T T A T G A C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |