Sequence ID | >WENV170001043 |
Genome ID | AGBJ01001446 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 109 |
End posion on genome | 185 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
aaacatatga |
tRNA gene sequence |
CGCGGGGTGGAGCAGTTTGGTAGCTCGTCAGGCTCATAACCTGAAGGTCGTAGGTTCGAA |
Downstream region at tRNA end position |
ttttatttaa |
Secondary structure (Cloverleaf model) | >WENV170001043 Met CAT a ACCT ttttatttaa C T G - C C - G G - C G - C G - C G - C T A T T G T C C A T G A G + + | | | G T C G A G G T A G G C T | | | | T T G G C T C G T A G AGGTC T - A C - G A - T G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |