Sequence ID | >WENV170001044 |
Genome ID | AGBJ01001446 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 197 |
End posion on genome | 273 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
tttatttaag |
tRNA gene sequence |
GGCGACGTAGCTCAGTTGGTTAGAGCATCGGAATCATAATCCGGGTGTCCGGGGTTCGAA |
Downstream region at tRNA end position |
ttacaattaa |
Secondary structure (Cloverleaf model) | >WENV170001044 Met CAT g ACCA ttacaattaa G + T G - C C - G G - C A - T C - G G - C T A T G T C C C A T G A A | + | | | G T C T C G C G G G G C G | | | | T T G G A G C T T A A GTGTC T + G C - G G - C G - C A - T A A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |