Sequence ID | >WENV170001045 |
Genome ID | AGBJ01001446 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 309 |
End posion on genome | 387 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
ataaataaaT |
tRNA gene sequence |
GCGCCAGTAGCTCAGCTGGATAGAGCAACGGCCTTCTAAGCCGTAGGCCAGAGGTTCGAA |
Downstream region at tRNA end position |
Acttcccact |
Secondary structure (Cloverleaf model) | >WENV170001045 Arg TCT T ATCC Acttcccact G + T C - G G - C C - G C - G A - T G - C T A T T C T C C A C G A A | | | | | G T C T C G A G A G G C G | | | | T T G G A G C A T A A AGGCC A - T C - G G - C G - C C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |