Sequence ID | >WENV170001046 |
Genome ID | AGBJ01001450 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 1811 |
End posion on genome | 1885 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
caatcattgt |
tRNA gene sequence |
TCCGGCATAGCTCAGCGGTAGAGTAGATGACTGTTAATCATTTGGTCCGAGGTTCGAATC |
Downstream region at tRNA end position |
cttcaaattt |
Secondary structure (Cloverleaf model) | >WENV170001046 Asn GTT t GCCA cttcaaattt T - A C - G C - G G - C G - C C - G A - T T A T G C T C C A G A A | | | | | G C C T C G C G A G G C G | | | + T T G G A G T T A A TGGTC G + T A - T T - A G - C A - T C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |