| Sequence ID | >WENV170001049 |
| Genome ID | AGBJ01001551 |
| Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
| Species | |
| Start position on genome | 226 |
| End posion on genome | 300 |
| Amino Acid | Lys |
| Anticodon | TTT |
| Upstream region at tRNA start position |
ttaatattat |
| tRNA gene sequence |
GGGCCGTTAGCTCAGACTGGTAGAGCAGCGGACTTTTAATCCGTTGGTCGGGAGTTCGAT |
| Downstream region at tRNA end position |
cccgcttttt |
| Secondary structure (Cloverleaf model) | >WENV170001049 Lys TTT
t ACtc cccgcttttt
G - C
G - C
G - C
C - G
C - G
G - C
T - A T T
T C C C T C A
A G A A | | | | | G
C C T C G G G G A G C
T | | | | T T
G G A G C
G T A A TGGTC
G + T
C - G
G - C
G - C
A - T
C A
T A
T T T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |