Sequence ID | >WENV170001049 |
Genome ID | AGBJ01001551 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 226 |
End posion on genome | 300 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
ttaatattat |
tRNA gene sequence |
GGGCCGTTAGCTCAGACTGGTAGAGCAGCGGACTTTTAATCCGTTGGTCGGGAGTTCGAT |
Downstream region at tRNA end position |
cccgcttttt |
Secondary structure (Cloverleaf model) | >WENV170001049 Lys TTT t ACtc cccgcttttt G - C G - C G - C C - G C - G G - C T - A T T T C C C T C A A G A A | | | | | G C C T C G G G G A G C T | | | | T T G G A G C G T A A TGGTC G + T C - G G - C G - C A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |