Sequence ID | >WENV170001050 |
Genome ID | AGBJ01001551 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 317 |
End posion on genome | 394 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
cttttttcgc |
tRNA gene sequence |
GTCCCCATCGTCTAGCCTGGTCCAGGACATCGGCCTTTCACGCCGACAACACCGGTTCAA |
Downstream region at tRNA end position |
ataatatcaa |
Secondary structure (Cloverleaf model) | >WENV170001050 Glu TTC c GCCA ataatatcaa G - C T - A C - G C - G C - G C - G A - T T A T T G G C C A C C G A C | | | | | A T T C T G A C C G G C G + | | | T T G G G A C T C C A A CAAC T - A C - G G - C G - C C - G C C T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |