Sequence ID | >WENV170001052 |
Genome ID | AGBJ01001607 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 568 |
End posion on genome | 494 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
catatacatg |
tRNA gene sequence |
GTGGGTGTAGTTCAGTGGTAGAGCACCGGATTGTGGTTCCGGGCGTCGTGGGTTCAAATC |
Downstream region at tRNA end position |
tttttttcaa |
Secondary structure (Cloverleaf model) | >WENV170001052 His GTG g CCCA tttttttcaa G - C T - A G - C G - C G - C T - A G - C T A T T A C C C A G A A + | | | | A T C T T G G T G G G C G | | + | T T G G A G C T A A GCGTC C - G C - G G - C G - C A - T T T T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |