Sequence ID | >WENV170001054 |
Genome ID | AGBJ01001608 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 853 |
End posion on genome | 780 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
gtgatttttc |
tRNA gene sequence |
GGGGGATTAGCTCAGCTGGGAGAGCATCGCCCTTGCACGGCGAAGGTCGTCGGTTCGAGC |
Downstream region at tRNA end position |
tttctgttct |
Secondary structure (Cloverleaf model) | >WENV170001054 Ala TGC c ACtg tttctgttct G - C G - C G + T G - C G - C A - T T - A C G T C T G C C A C G A A | | | | G T C T C G G T C G G C G | | | | T T G G A G C G A A AGGTC T - A C - G G - C C - G C - G C C T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |