Sequence ID | >WENV170001057 |
Genome ID | AGBJ01001790 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 732 |
End posion on genome | 824 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
tattatgggt |
tRNA gene sequence |
GGAGAGATGGCAGAGTCCGGTTAAATGCGCCGCACTCGAAATGCGGTTTCCGATTTTTTC |
Downstream region at tRNA end position |
tgaaacttta |
Secondary structure (Cloverleaf model) | >WENV170001057 Ser CGA t GCAA tgaaacttta G - C G - C A - T G - C A - T G - C A - T T A T T T C C C A C T G A G + + | | | G C G A C G G G G G G C G | | | T T G A T G C T T A A G TTTCCGATTTTTTCGGAAC C - G C - G G - C C - G A - T C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |