Sequence ID | >WENV170001058 |
Genome ID | AGBJ01001796 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 1655 |
End posion on genome | 1584 |
Amino Acid | Ala |
Anticodon | CGC |
Upstream region at tRNA start position |
gaataatttt |
tRNA gene sequence |
GGGCCTATGGTCTAAGGGCATGATGCCACATTCGCATTGTGGAGATGGCAGTTCGACTCT |
Downstream region at tRNA end position |
atgaaatcaa |
Secondary structure (Cloverleaf model) | >WENV170001058 Ala CGC t ACtt atgaaatcaa G - C G - C G + T C - G C - G T - A A - T T C T C C G T C A A A G | | | | | G G T C T G G G C A G C G | | + T T G T G A T C A G AGAT C - G C - G A - T C - G A - T T T T A C G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |