Sequence ID | >WENV170001064 |
Genome ID | AGBJ01001967 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 1220 |
End posion on genome | 1148 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
ttggaggtaa |
tRNA gene sequence |
GCCGAGATAGCTCAGACGGTAGAGCAGGGGACTGAAAATCCCCGTGTCCGCAGTTCAATT |
Downstream region at tRNA end position |
tagtgaaata |
Secondary structure (Cloverleaf model) | >WENV170001064 Phe GAA a Ataa tagtgaaata G - C C - G C - G G - C A - T G - C A - T T T T G C G T C A A G A A | | | | | A C C T C G C G C A G C G | | | | T T G G A G C T A A GTGTC G - C G - C G - C G - C A - T C A T A G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |