Sequence ID | >WENV170001065 |
Genome ID | AGBJ01002028 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 1254 |
End posion on genome | 1330 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
gagaagtttt |
tRNA gene sequence |
GCGCCTGTAGCTCAGTTGGATAGAGCAGCGGACTTCTAATCCGCAGGTCGGGGGTTCGAA |
Downstream region at tRNA end position |
ttttgttcta |
Secondary structure (Cloverleaf model) | >WENV170001065 Arg TCT t ACCA ttttgttcta G - C C - G G - C C - G C - G T - A G - C T A T C T C C C A T G A A | + | | | G T C T C G G G G G G C G | | | | T T G G A G C A T A A AGGTC G - C C - G G - C G - C A - T C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |