Sequence ID | >WENV170001067 |
Genome ID | AGBJ01002230 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 213 |
End posion on genome | 123 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
cccccccaat |
tRNA gene sequence |
GGAGGGATGTCCGAGTGGTTTAAGGAGGCGGTCTTGAAAACCGTTGTCTGCTTAAGGTGG |
Downstream region at tRNA end position |
ggaaatttaa |
Secondary structure (Cloverleaf model) | >WENV170001067 Ser TGA t GCCA ggaaatttaa G - C G - C A - T G - C G - C G - C A - T T A T C A T C C A T G A G | | + | | G G G C C T G T G G G C G | | | T T T A G G A T T A G TGTCTGCTTAAGGTGGACC G + T C - G G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |