Sequence ID | >WENV170001068 |
Genome ID | AGBJ01002246 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 447 |
End posion on genome | 375 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
tttggaaata |
tRNA gene sequence |
TCTGGAGTAGCTCAGCGGCAGAGCGGGTGGCTGTTAACCACTAGGTCGTGGGTTCAAATC |
Downstream region at tRNA end position |
tttactaaat |
Secondary structure (Cloverleaf model) | >WENV170001068 Asn GTT a GCtt tttactaaat T - A C - G T - A G - C G - C A - T G - C T A T C T C C C A G A A | | | | A C C T C G G T G G G C G | | | | T T G G A G C C A G AGGTC G + T G - C T - A G - C G - C C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |