Sequence ID | >WENV170001072 |
Genome ID | AGBJ01002531 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 1021 |
End posion on genome | 1112 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
tttgaattta |
tRNA gene sequence |
GGAGAGATGCCAGAGTGGTTGAATGGGGCGGTCTCGAAAATCGCTGTCCGTCAGCTGACG |
Downstream region at tRNA end position |
ctttgattat |
Secondary structure (Cloverleaf model) | >WENV170001072 Ser CGA a GCCA ctttgattat G - C G - C A - T G - C A - T G - C A - T T A T C A C C C A T G A G | | | | | G G G A C C G T G G G C G | | | T T T A T G G T G A G TGTCCGTCAGCTGACGGACC G - C C - G G - C G + T T - A C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |