Sequence ID | >WENV170001073 |
Genome ID | AGBJ01002606 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 1044 |
End posion on genome | 1116 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
aattgaattc |
tRNA gene sequence |
GGGGGTGTAGCTCAGTTGGGAGAGCACCTGCTTTGCACGCAGGAGGTCATCGGTTCGATC |
Downstream region at tRNA end position |
tataattcta |
Secondary structure (Cloverleaf model) | >WENV170001073 Ala TGC c Atta tataattcta G - C G - C G + T G - C G - C T - A G - C C T T T T G C C A T G A A | | | | G T C T C G A T C G G C G | | | | T T G G A G C G A A AGGTC C - G C - G T - A G - C C - G T C T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |