Sequence ID | >WENV170001075 |
Genome ID | AGBJ01002618 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 1098 |
End posion on genome | 1170 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
ttttggtgaa |
tRNA gene sequence |
GCGGTGGTAACTCAGGGGTAGAGTACTTGCTTCCCAAGCAAGCTGTCGCGGGTTCGAATC |
Downstream region at tRNA end position |
tttttaaatg |
Secondary structure (Cloverleaf model) | >WENV170001075 Gly CCC a TCtt tttttaaatg G - C C - G G - C G - C T + G G - C G - C T A T T G C C C A G A A + | | | | G G C T C A G C G G G C G | | | | T T G G A G T T A A CTGTC C - G T - A T - A G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |