Sequence ID | >WENV170001076 |
Genome ID | AGBJ01002620 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 845 |
End posion on genome | 772 |
Amino Acid | Arg |
Anticodon | TCG |
Upstream region at tRNA start position |
agaaatttaa |
tRNA gene sequence |
GCGCCCGTAGCTCAGTTGGATAGAGCGCCGGGCTTCGAACCCGTAGGTCGCAGGTTCGAA |
Downstream region at tRNA end position |
aaatctttag |
Secondary structure (Cloverleaf model) | >WENV170001076 Arg TCG a Attt aaatctttag G - C C - G G - C C - G C - G C - G G - C T A T C G T C C A T G A A | | | | | G T C T C G G C A G G C G | | | | T T G G A G C A T A G AGGTC C T C - G G - C G - C G - C C A T A T C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |