| Sequence ID | >WENV170001077 |
| Genome ID | AGBJ01002620 |
| Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
| Species | |
| Start position on genome | 757 |
| End posion on genome | 681 |
| Amino Acid | Lys |
| Anticodon | CTT |
| Upstream region at tRNA start position |
aatctttaga |
| tRNA gene sequence |
GGGCCGTTAGCTCAATCAGGCAGAGCAACTGACTCTTAATCAGTAGGTTATAGGTTCGAT |
| Downstream region at tRNA end position |
taaattaagc |
| Secondary structure (Cloverleaf model) | >WENV170001077 Lys CTT
a ACCA taaattaagc
G + T
G - C
G - C
C - G
C - G
G - C
T - A T T
T T A T C C A
T A A A | | | | | G
C C T C G A T A G G C
A | | | | T T
G G A G C
G C A A AGGTT
A - T
C - G
T - A
G - C
A - T
C A
T A
C T T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |