Sequence ID | >WENV170001077 |
Genome ID | AGBJ01002620 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 757 |
End posion on genome | 681 |
Amino Acid | Lys |
Anticodon | CTT |
Upstream region at tRNA start position |
aatctttaga |
tRNA gene sequence |
GGGCCGTTAGCTCAATCAGGCAGAGCAACTGACTCTTAATCAGTAGGTTATAGGTTCGAT |
Downstream region at tRNA end position |
taaattaagc |
Secondary structure (Cloverleaf model) | >WENV170001077 Lys CTT a ACCA taaattaagc G + T G - C G - C C - G C - G G - C T - A T T T T A T C C A T A A A | | | | | G C C T C G A T A G G C A | | | | T T G G A G C G C A A AGGTT A - T C - G T - A G - C A - T C A T A C T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |