Sequence ID | >WENV170001082 |
Genome ID | AGBJ01002763 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 512 |
End posion on genome | 439 |
Amino Acid | Gln |
Anticodon | CTG |
Upstream region at tRNA start position |
agattaatat |
tRNA gene sequence |
TGGGGGATCGTTTAGTGGCAAGACGGCAGGTTCTGGCCCTGCAAACCAAGGTTCGAATCC |
Downstream region at tRNA end position |
ttgcatagtc |
Secondary structure (Cloverleaf model) | >WENV170001082 Gln CTG t GCCA ttgcatagtc T - A G - C G - C G - C G - C G - C A - T T A T G T T C C A G A C | | | | | G T T T T G C A A G G C G | + | | T T G A G A C C A G AAAC G - C C - G A - T G - C G - C T C T G C T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |