Sequence ID | >WENV170001083 |
Genome ID | AGBJ01002763 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 342 |
End posion on genome | 267 |
Amino Acid | Glu |
Anticodon | CTC |
Upstream region at tRNA start position |
ttatttatgg |
tRNA gene sequence |
GGTCCCATCGTCTAGCGGTTTAGGACGCCGGCCTCTCACGCCGGTAACACGGGTTCGAGT |
Downstream region at tRNA end position |
gtgaatacaa |
Secondary structure (Cloverleaf model) | >WENV170001083 Glu CTC g ACCA gtgaatacaa G + T G - C T - A C - G C - G C - G A - T T G T T G C C C A C G A C | | | | | G G T C T G A C G G G C G + | | | T T T G G A C T T A G TAAC C - G C - G G - C G - C C - G C C T A C T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |