Sequence ID | >WENV170001084 |
Genome ID | AGBJ01002773 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 845 |
End posion on genome | 769 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
aaataaaaaa |
tRNA gene sequence |
GCCCCTGTAGCTTAATTGGATAAAGCAGGGCCCTTCTAAGGCCAAGAGTGCAGGTTCGAG |
Downstream region at tRNA end position |
tggagacctt |
Secondary structure (Cloverleaf model) | >WENV170001084 Arg TCT a ACCA tggagacctt G - C C - G C - G C - G C - G T + G G - C T G T C G T C C A T A A A | | | | | G T T T C G G C A G G C G | | | | T T G A A G C A T A A AGAGT G A G - C G - C C - G C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |