Sequence ID | >WENV170001086 |
Genome ID | AGBJ01003223 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 884 |
End posion on genome | 809 |
Amino Acid | Ala |
Anticodon | GGC |
Upstream region at tRNA start position |
tttgttatgt |
tRNA gene sequence |
GGGGCTGTAGCTCAGATGGGAGAGCACATGACTGGCAGTCATGAGGTCAGGGGTTCGATC |
Downstream region at tRNA end position |
atacaaatag |
Secondary structure (Cloverleaf model) | >WENV170001086 Ala GGC t ACCA atacaaatag G - C G - C G + T G - C C - G T - A G - C C T T T C C C C A A G A A | | | | | G T C T C G A G G G G C G | | | | T T G G A G C G A A AGGTC C - G A - T T - A G - C A - T C G T A G G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |