Sequence ID | >WENV170001087 |
Genome ID | AGBJ01003250 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 819 |
End posion on genome | 892 |
Amino Acid | Gln |
Anticodon | CTG |
Upstream region at tRNA start position |
cctactagat |
tRNA gene sequence |
TGGGAGATCGTCTAAAGGTAGGACAACAGGTTCTGGTCCTGTCGGTGGGGGTTCGAATCC |
Downstream region at tRNA end position |
ctctccagaa |
Secondary structure (Cloverleaf model) | >WENV170001087 Gln CTG t ACCA ctctccagaa T - A G - C G - C G - C A - T G - C A - T T A T C C T C C A A A C | | + | | G A T C T G G G G G G C G + | | | T T G G G A C T A A CGGT A - T C - G A - T G - C G - C T T T G C T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |