Sequence ID | >WENV170001088 |
Genome ID | AGBJ01003588 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 898 |
End posion on genome | 969 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
attataaaat |
tRNA gene sequence |
GCCAGGGTAGCTCAACGGCAGAGCAACGGTTTTGTAAACCGTAGGCTATGGGTTCGAATC |
Downstream region at tRNA end position |
ttattttatt |
Secondary structure (Cloverleaf model) | >WENV170001088 Thr TGT t Tttt ttattttatt G - C C - G C - G A - T G - C G - C G - C T A T T T C C C A A A A | | | | G C C T C G A T G G G C G | | | | T T G G A G C C A A AGGCT A - T C - G G - C G - C T - A T A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |