Sequence ID | >WENV170001089 |
Genome ID | AGBJ01003746 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 567 |
End posion on genome | 472 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
ggcatggata |
tRNA gene sequence |
GGAGAGGTACCGAAGTGGTCGTAACGGGGTCGACTCGAAATCGATTTGTCTCGTTAAGAG |
Downstream region at tRNA end position |
ggaaatgtca |
Secondary structure (Cloverleaf model) | >WENV170001089 Ser CGA a GCCA ggaaatgtca G - C G - C A - T G - C A - T G - C G - C T A T C A C C C A G T G A A | | | | | G G A G C C G T G G G C T | | | T T C A C G G G T A G TTGTCTCGTTAAGAGCGGGGCAC G + T T - A C - G G - C A - T C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |