Sequence ID | >WENV170001090 |
Genome ID | AGBJ01003746 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 355 |
End posion on genome | 262 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
gtaaaataac |
tRNA gene sequence |
GGAGAGATGTCCGAGTTGGCTTAAGGAGCGCGACTGGAAATCGCGTGTACTACCACAAGT |
Downstream region at tRNA end position |
gatacactgt |
Secondary structure (Cloverleaf model) | >WENV170001090 Ser GGA c GCCA gatacactgt G - C G - C A - T G - C A - T G - C A - T T A T C C C C C A T T G A G | | | | | G G G C C T G G G G G C G | | | T T C A G G A T T A G TGTACTACCACAAGTGGTACC C - G G - C C - G G - C A - T C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |